• Artykuły
  • Forum
  • Ciekawostki
  • Encyklopedia
  • Sekwencjonowanie DNA



    Podstrony: 1 [2] [3] [4]
    Przeczytaj także...
    Science – recenzowane czasopismo naukowe wydawane przez American Association for the Advancement of Science. Ukazuje się jako tygodnik ilustrowany.Projekt Genograficzny ((ang.) The Genographic Project) jest powstałym 13 kwietnia 2005 roku wspólnym przedsięwzięciem National Geographic Society i firmy IBM mającym za cel ustalenie tras prehistorycznych migracji ludzi. Badania w założeniu miały trwać pięć lat, ale zostały przedłużone do końca roku 2011 i polegają na zbieraniu oraz analizie próbek DNA od setek tysięcy ludzi z całego świata. Są to pierwsze badania antropologii genetycznej na tak szeroką skalę.

    Sekwencjonowanie DNA – technika odczytywania sekwencji, czyli kolejności par nukleotydowych w cząsteczce DNA.

    Sekwencjonowanie dokonuje się obecnie głównie za pomocą zautomatyzowanych sekwenatorów. Manualne sekwencjonowanie stosuje się przy opracowywaniu nowatorskich metod, w niektórych laboratoriach dla krótkich fragmentów lub podczas ćwiczeń.

  • Przykład sekwencji DNA (początek operonu laktozowego E. coli z GenBank):
  • GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGG
    
    gdzie: A – deoksyadenozyna; C – deoksycytydyna; G – deoksyguanozyna; T – tymidyna

    Metody historyczne[ | edytuj kod]

    Sekwencjonowania DNA metodą Sangera z użyciem znakowanych dideoksynukleotydów
    A – przykładowa sekwencja DNA
    B – przyłączenie startowego oligonukleotydu do nici matrycowej i kierunek syntezy DNA
    C – produkty syntezy DNA, zakończone fluorescencyjnie znakowanymi dideoksynukleotydami (kolorowe litery)
    D – elektroforegram rozdziału otrzymanej mieszaniny fragmentów w elektroforezie kapilarnej wraz z zidentyfikowaną sekwencją (powyżej)
    Przykładowy pirogram uzyskany z pirosekwencjonowania

    Historyczną już i wypieraną metodą jest opracowana w 1977 r. metoda Sangera, oparta o syntezę DNA przez polimerazę DNA in vitro. Do reakcji dodaje się niewielką ilość trifosforanów dideoksynukleotydów (ddNTP), które są wbudowywane w DNA, ale ich dołączenie uniemożliwia dalsze wydłużanie nici. W ten sposób otrzymuje się fragmenty DNA o różnej długości zakończone specyficznym nukleotydem. Produkty reakcji rozdziela się elektroforetycznie, co powoduję ich segregację pod względem wielkości.

    Fluorescencja – jeden z rodzajów luminescencji – zjawiska emitowania światła przez wzbudzony atom lub cząsteczkę. Zjawisko uznaje się za fluorescencję, gdy po zaniku czynnika pobudzającego następuje szybki zanik emisji w czasie około 10 s. Gdy czas zaniku jest znacznie dłuższy, to zjawisko jest uznawane za fosforescencję.X PRIZE Foundation – organizacja non-profit fundująca nagrody w celu stymulacji publicznego współzawodnictwa. Organizacja ogłosiła przyznanie nagród o różnych wysokościach za osiągnięcie wymaganych kryteriów w różnych dziedzinach nauki i techniki.

    Autorem alternatywnej metody sekwencjonowania DNA, z wykorzystaniem specyficznej, chemicznej degradacji DNA, byli Walter Gilbert i Allan Maxam (metoda Maxama-Gilberta). Gilbert wraz z Frederickiem Sangerem otrzymali za to osiągnięcie nagrodę Nobla w dziedzinie chemii. Metoda Maxama-Gilberta obecnie jest rzadko stosowana.

    Walter Gilbert (ur. 21 marca 1932 w Bostonie) – amerykański fizyk, chemik, biolog, laureat Nagrody Nobla w dziedzinie chemii.Metoda Sangera (metoda dideoksy) – jeden ze sposobów sekwencjonowania DNA; opracowany przez Fredericka Sangera. i nagrodzony nagrodą Nobla w 1980 roku; do dziś stanowi (z różnymi modyfikacjami) podstawę odczytywania sekwencji DNA. Metoda ta polega na kopiowaniu badanej cząsteczki DNA w warunkach in vitro, katalizowanym przez enzym polimerazę DNA.


    Podstrony: 1 [2] [3] [4]




    Warto wiedzieć że... beta

    PMID (ang. PubMed Identifier, PubMed Unique Identifier) – unikatowy identyfikator przypisany do każdego artykułu naukowego bazy PubMed.
    Tranzystor polowy DNA (skrót ang. DNAFET) to tranzystor polowy wykorzystujący efekt polowy ładunków w DNA cząsteczce. Taki tranzystor pełni funkcję biosensora lub może być wykorzystywany do odczytu równoległych obliczeń z wykorzystaniem masowej hybrydyzacji ssDNA.
    Kapilara – bardzo cienka rurka, tak cienka, że praktycznie cała ciecz przepływająca przez nią znajduje się w polu oddziaływania sił związanych jej ściankami i cieczy bezpośrednio przylegającej do ścianek, w wyniku czego prędkość poruszania się cząsteczek silnie zależy od odległości od ścianek (profil paraboliczny). W kapilarnych kolumnach do chromatografii gazowej praktycznie wszystkie cząsteczki przepływającego gazu znajdują się w polu oddziaływania fazy stacjonarnej, np. cieczy pokrywającej wewnętrzne ścianki rurki.
    Para zasad (pz lub bp z (ang.) base pair) - w biologii molekularnej - komplementarne, połączone wiązaniami wodorowymi zasady azotowe nukleotydów dwóch różnych nici kwasu nukleinowego. W parach zasad podaje się długość cząsteczek DNA.
    In vitro (łac. w szkle) – termin stosowany przy opisywaniu badań biologicznych, oznacza procesy biologiczne przeprowadzane w warunkach laboratoryjnych, poza organizmem.
    Enzymy – wielkocząsteczkowe, w większości białkowe, katalizatory przyspieszające specyficzne reakcje chemiczne poprzez obniżenie ich energii aktywacji.
    Genom – materiał genetyczny zawarty w podstawowym (haploidalnym) zespole chromosomów. Termin mylony jest z genotypem, czyli całością informacji genetycznej zawartej w chromosomach organizmu.

    Reklama

    Czas generowania strony: 0.042 sek.