Sekwencjonowanie DNA

Z Wikipedii, wolnej encyklopedii
Przejdź do nawigacji Przejdź do wyszukiwania

Sekwencjonowanie DNA – technika odczytywania sekwencji, czyli kolejności par nukleotydowych w cząsteczce DNA.

Fluorescencja – jeden z rodzajów luminescencji – zjawiska emitowania światła przez wzbudzony atom lub cząsteczkę. Zjawisko uznaje się za fluorescencję, gdy po zaniku czynnika pobudzającego następuje szybki zanik emisji w czasie około 10 s. Gdy czas zaniku jest znacznie dłuższy, to zjawisko jest uznawane za fosforescencję.X PRIZE Foundation – organizacja non-profit fundująca nagrody w celu stymulacji publicznego współzawodnictwa. Organizacja ogłosiła przyznanie nagród o różnych wysokościach za osiągnięcie wymaganych kryteriów w różnych dziedzinach nauki i techniki.

Sekwencjonowanie dokonuje się obecnie głównie za pomocą zautomatyzowanych sekwenatorów. Manualne sekwencjonowanie stosuje się przy opracowywaniu nowatorskich metod, w niektórych laboratoriach dla krótkich fragmentów lub podczas ćwiczeń.

  • Przykład sekwencji DNA (początek operonu laktozowego E. coli z GenBank):
  • GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGG
    
    gdzie: A – deoksyadenozyna; C – deoksycytydyna; G – deoksyguanozyna; T – tymidyna

    Metody historyczne[ | edytuj kod]

    Sekwencjonowania DNA metodą Sangera z użyciem znakowanych dideoksynukleotydów
    A – przykładowa sekwencja DNA
    B – przyłączenie startowego oligonukleotydu do nici matrycowej i kierunek syntezy DNA
    C – produkty syntezy DNA, zakończone fluorescencyjnie znakowanymi dideoksynukleotydami (kolorowe litery)
    D – elektroforegram rozdziału otrzymanej mieszaniny fragmentów w elektroforezie kapilarnej wraz z zidentyfikowaną sekwencją (powyżej)
    Przykładowy pirogram uzyskany z pirosekwencjonowania

    Historyczną już i wypieraną metodą jest opracowana w 1977 r. metoda Sangera, oparta o syntezę DNA przez polimerazę DNA in vitro. Do reakcji dodaje się niewielką ilość trifosforanów dideoksynukleotydów (ddNTP), które są wbudowywane w DNA, ale ich dołączenie uniemożliwia dalsze wydłużanie nici. W ten sposób otrzymuje się fragmenty DNA o różnej długości zakończone specyficznym nukleotydem. Produkty reakcji rozdziela się elektroforetycznie, co powoduję ich segregację pod względem wielkości.

    Walter Gilbert (ur. 21 marca 1932 w Bostonie) – amerykański fizyk, chemik, biolog, laureat Nagrody Nobla w dziedzinie chemii.Metoda Sangera (metoda dideoksy) – jeden ze sposobów sekwencjonowania DNA; opracowany przez Fredericka Sangera. i nagrodzony nagrodą Nobla w 1980 roku; do dziś stanowi (z różnymi modyfikacjami) podstawę odczytywania sekwencji DNA. Metoda ta polega na kopiowaniu badanej cząsteczki DNA w warunkach in vitro, katalizowanym przez enzym polimerazę DNA.

    Autorem alternatywnej metody sekwencjonowania DNA, z wykorzystaniem specyficznej, chemicznej degradacji DNA, byli Walter Gilbert i Allan Maxam (metoda Maxama-Gilberta). Gilbert wraz z Frederickiem Sangerem otrzymali za to osiągnięcie nagrodę Nobla w dziedzinie chemii. Metoda Maxama-Gilberta obecnie jest rzadko stosowana.

    Nationalencyklopedin – największa, szwedzka encyklopedia współczesna. Jej stworzenie było możliwe dzięki kredytowi w wysokości 17 mln koron, którego udzielił rząd szwedzki w 1980 roku i który został spłacony w 1990. Drukowana wersja składa się z 20 tomów i zawiera 172 tys. haseł. Wersja internetowa zawiera 260 tys. haseł (stan z czerwca 2005). Inicjatorem projektu był rząd szwedzki, który rozpoczął negocjacje z różnymi wydawcami. Negocjacje zakończyły się w 1985, kiedy na wydawcę został wybrany Bra Böcker z Höganäs. Encyklopedia miała uwzględniać kwestie genderowe i związane z ochroną środowiska. Pierwszy tom ukazał się w 1989 roku, ostatni w 1996. Dodatkowo w roku 2000 ukazały się trzy dodatkowe tomy. Encyklopedię zamówiło 54 tys. osób. W 1997 roku ukazało się wydanie elektroniczne na CD, a w 2000 pojawiło się wydanie internetowe, które jest uzupełniane na bieżąco.PMID (ang. PubMed Identifier, PubMed Unique Identifier) – unikatowy identyfikator przypisany do każdego artykułu naukowego bazy PubMed.


    Podstrony: 1 [2] [3] [4]




    Warto wiedzieć że... beta

    Tranzystor polowy DNA (skrót ang. DNAFET) to tranzystor polowy wykorzystujący efekt polowy ładunków w DNA cząsteczce. Taki tranzystor pełni funkcję biosensora lub może być wykorzystywany do odczytu równoległych obliczeń z wykorzystaniem masowej hybrydyzacji ssDNA.
    Kapilara – bardzo cienka rurka, tak cienka, że praktycznie cała ciecz przepływająca przez nią znajduje się w polu oddziaływania sił związanych jej ściankami i cieczy bezpośrednio przylegającej do ścianek, w wyniku czego prędkość poruszania się cząsteczek silnie zależy od odległości od ścianek (profil paraboliczny). W kapilarnych kolumnach do chromatografii gazowej praktycznie wszystkie cząsteczki przepływającego gazu znajdują się w polu oddziaływania fazy stacjonarnej, np. cieczy pokrywającej wewnętrzne ścianki rurki.
    Para zasad (pz lub bp z (ang.) base pair) - w biologii molekularnej - komplementarne, połączone wiązaniami wodorowymi zasady azotowe nukleotydów dwóch różnych nici kwasu nukleinowego. W parach zasad podaje się długość cząsteczek DNA.
    In vitro (łac. w szkle) – termin stosowany przy opisywaniu badań biologicznych, oznacza procesy biologiczne przeprowadzane w warunkach laboratoryjnych, poza organizmem.
    Encyklopedia Britannica (ang. Encyclopædia Britannica) – najstarsza wydawana do chwili obecnej i najbardziej prestiżowa encyklopedia angielskojęzyczna. Artykuły w niej zamieszczane uważane są powszechnie przez czytelników za obiektywne i wiarygodne.
    Enzymy – wielkocząsteczkowe, w większości białkowe, katalizatory przyspieszające specyficzne reakcje chemiczne poprzez obniżenie ich energii aktywacji.
    Genom – materiał genetyczny zawarty w podstawowym (haploidalnym) zespole chromosomów. Termin mylony jest z genotypem, czyli całością informacji genetycznej zawartej w chromosomach organizmu.

    Reklama