• Artykuły
  • Forum
  • Ciekawostki
  • Encyklopedia
  • FASTA format

    Przeczytaj także...
    Kwasy nukleinowe – organiczne związki chemiczne, biopolimery zbudowane z nukleotydów. Zostały odkryte w roku 1869 przez Johanna Friedricha Mieschera. Znane są dwa podstawowe typy naturalnych kwasów nukleinowych: kwasy deoksyrybonukleinowe (DNA) i rybonukleinowe (RNA). Komórki wszystkich organizmów na Ziemi zawierają zarówno DNA i RNA, kwas nukleinowy znajduje się także w wirionach wirusów, co jest podstawą ich podziału na wirusy RNA i wirusy DNA.Białka – wielkocząsteczkowe (masa cząsteczkowa od ok. 10 000 do kilku mln Daltonów) biopolimery, a właściwie biologiczne polikondensaty, zbudowane z reszt aminokwasów połączonych ze sobą wiązaniami peptydowymi -CONH-. Występują we wszystkich żywych organizmach oraz wirusach. Synteza białek odbywa się przy udziale specjalnych organelli komórkowych zwanych rybosomami.
    Aminokwasy – organiczne związki chemiczne zawierające zasadową grupę aminową -NH2 oraz kwasową grupę karboksylową -COOH lub – w ujęciu ogólniejszym – dowolną grupę kwasową, np. sulfonową -SO3H. Aminokwasy są tzw. solami wewnętrznymi (amfolitami).

    Format FASTA – format zapisu sekwencji kwasów nukleinowych oraz białek używanym w bioinformatyce. Nukleotydy (dla DNA i RNA) oraz aminokwasy (dla białek) oznaczone są jednoliterowymi skrótami. Format FASTA uwzględnia również możliwość dodawania opisów i komentarzy do sekwencji.

    Format[ | edytuj kod]

    Dane zapisane w formacie FASTA składają się z pojedynczej linii tekstu zawierającej opis sekwencji oraz z kolejnych linii zawierających samą sekwencję. Linia z opisem rozpoczyna się od znaku "większe niż" (">"). Pierwsze słowo po tym znaku służy jako identyfikator sekwencji. Dalej w tej samej linii umieszczany jest opis. W kolejnych liniach znajduje się ciąg znaków składający się na sekwencję. Przykładowa sekwencje w formacie FASTA wygląda tak:

    >Keratyna 5, egzon 2, Homo sapiens
    GTGCGGTTCCTGGAGCAGCAGAACAAGGTTCTGGACACCAAGTGGACCCTGCTGCAGGAG
    CAGGGCACCAAGACTGTGAGGCAGAACCTGGAGCCGTTGTTCGAGCAGTACATCAACAAC
    CTCAGGAGGCAGCTGGACAGCATCGTGGGGGAACGGGGCCGCCTGGACTCAGAGCTGAGA
    AACATGCAGGACCTGGTGGAAGACTTCAAGAACAA
    

    Oznaczenia literowe[ | edytuj kod]

    Nukleotydy są oznaczane za pomocą:

    Aminokwasy są określane za pomocą:





    Reklama

    Czas generowania strony: 0.759 sek.